EST details — SGN-E377161

Search information 
Request: 377161Match: SGN-E377161
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175567Clone name: TUS-21-K21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175567 is on microarray TOM1 spot ID 1-1-4.3.13.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15498 [cLED-13-B24] Trace: SGN-T51899 EST: SGN-E236621 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377161Length: 726 bp (904 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E377161 [] (trimmed) CAATGGCGTTCTCTGCAACTCTTCGATGTTCATCTTCTCTACACCGCCCTTCGAAGAATTCAACAATTTCAAGCGTTTTGCCTCAATCATCTTCT
TCAATCTCCTTTCGATCTTCGCCTTCGTTTTTTAATCGCAAAAAATCATTGTCTATTCGATCTGCTACACTTGAAGCAGCACCTGCATCTGGAGG
AGTAGCACCTGCAATTTCCTTAACTGACAATGCATTAATGCACTTGAATAAAATGAGGAGTGATCGGAATGAGGACTTGTGTCTTAGAATTGGCG
TTAAACAAGGGGGATGCTCGGGAATGTCATACACTATGGAGTTTGAAAAGCGAGAAAATGCTAGACCAGACGATTCAATCATCGAGTACAATGGA
TTTGTTATTGTTTGTGATCCAAAAAGCCTTCTCTTCATCTTCGGAATGCAACTGGACTACAGCGATGCATTGATAGGCGGGGGCTTCTCTTTCAA
AAATCCAAACGCTACGCAAACTTGTGGTTGTGGAAAATCGTTTACTGCTGAGATGTAAGAGCATGCAGTCTTAGAAATGTACTACAAAATTAACA
TACTAGAACACCAACTGTGGTTTGCTTGGTTCTCTGAATATAGACAGAGACAGTAATGAAGATCTGTTAACTCATATTATGTGCATAAGGGACTG
TAACGTTTAAATATGTGTAACTGGGAATGCATTATATTCTTCCTGCACAAAATACAAAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377161] SGN-U575652 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190352 [Download][View] Facility Assigned ID: FA0AAD9AF11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5