EST details — SGN-E377706

Search information 
Request: 377706Match: SGN-E377706
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175120Clone name: TUS-20-I6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175120 is on microarray TOM1 spot ID 1-1-3.1.14.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23973 [cLED-6-N2] Trace: SGN-T50100 EST: SGN-E233114 Direction: 5' Facility: TIGR
Clone: SGN-C175120 [TUS-20-I6] Trace: SGN-T189916 EST: SGN-E377705 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377706Length: 698 bp (925 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E377706 [] (trimmed) TAATTTGTGTGTTAAACAAGAATCCAAAGGGAAGTTTCTTACAAACTCCCCACATTTCAGTTAGCTAGCTACTATAAATTAACTCATAATTACAC
CATTTTCTTAATTAATTCCTCTAAATTAAAGAATAATGGGTGTTGGAGGAACATTAGAGTATATCTCAGAAATGATGAGTATTGAAAAGCCAAAG
AAGAAGAAGAAGCAGTTTAATACAGTGGAACTTAAAGTTAGAATGGATTGTGAGGGCTGTGAAATGAAAGTCAAAAATACATTATCTTCCATGAG
TGGAGTGAAATCAGTGGAGATAAACAGGAAACAACAGAAGGTGACAGTAACAGGCTATGTGGAACCAAACAAAGTGTTAAAGAAGGCAAAGTCAA
CTGGAAAGAAGGCAGAGATATGGCCTTATATCCCATACAATTTGGTATCCCAGCCATATGCTGCTCAAGCTTATGATAAAAAGGCGCCTCCTGGC
TACGTCAGGAGGGTCGATCAGTACCCAACCACGGGTACTGTTGCGAGATATGAGGATCCTTCCTATGTCAACATGTTTAGTGATGACAATCCTAA
TGCTTGTTCCATCATGTAACTTATTAAGGTACGAGAAAGCTACTGAAAGATGGCACGAGAAAACACAAGTTCTTGAGCCGAAATGGGTCTATCAG
AAATAGCTTCGGATTTCACTAATAAAATCACGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377706] SGN-U573520 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189917 [Download][View] Facility Assigned ID: FA0AAD8BE03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5