Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E377994

Search information 
Request: 377994Match: SGN-E377994
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175198Clone name: TUS-20-L12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175198 is on microarray TOM1 spot ID 1-1-5.4.13.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24091 [cLED-7-D1] Trace: SGN-T50559 EST: SGN-E232050 Direction: 5' Facility: TIGR
Clone: SGN-C175198 [TUS-20-L12] Trace: SGN-T190217 EST: SGN-E377995 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377994Length: 685 bp (929 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E377994 [] (trimmed) GCTGCAATCTATTGTTTTAATTCAGTAAACTTTCTCAAGGCTGACAACATGAAATAGTTGTTCAAAATTGTAAACAACTGAATGTCTCGAGATAA
AAGGCTAAAAACCAGATAATGCAAAAATATTAAGCAAAACGATAATGTCTCAAAAAGGTCAAGCAGATCAACGGTAACGGCGGAGAGATAGAGTC
TGGTTCCTTTTCCAGGTTGCCCTTCTTGACGGGCGAGCTTTGTGGTGGAGATGTCCTCTTCCGCGGAGTCCTCTGTATTTCTTACCAGCTGAAGT
GAGACCACGTAGTTCTCTGTGCTTATGCACTGGGTTGCAGATCCAGTTGATCCTTGGATCGTTGCGAATACCAGCATGGGCTTGGTCAACCAATA
TTACCTCAAAGTACTTGTAGGTAGAATCCTCATTAATCCAGTAAGAATTGAGGACTCTAAGACCACCCAATTTCCTTCCAGCACGCTCCTCAGCA
ACAGATCGCTTGCTGCGCTGGAATTTGAGTTGGGTAACTCCCTGGTTGGTGGGTTTACCATACACAATACCCTTGGACACTGGCCTCTTCCTTCC
ACCACGTTTCACACGAACACGGTAGACCACATAGCCCTGCTTGGCCTTGTAACCCAATCGGCGTGCCTTGTCAGGACGGGTAGGCCTGGTGACAC
GGACAATAGATGGGAGCTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377994] SGN-U565717 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190216 [Download][View] Facility Assigned ID: FA0AAD8DF06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.991 Expected Error Rate: 0.0066 Quality Trim Threshold: 12.5