Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E378195

Search information 
Request: 378195Match: SGN-E378195
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180300Clone name: TUS-34-A2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180300 is on microarray TOM1 spot ID 1-1-7.1.19.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28078 [cLEF-46-H9] Trace: SGN-T61726 EST: SGN-E247315 Direction: 5' Facility: TIGR
Clone: SGN-C180300 [TUS-34-A2] Trace: SGN-T193527 EST: SGN-E392201 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378195Length: 427 bp (1199 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378195 [] (trimmed) GGAGATTTTCAGGCTGTACTTAGCACTTTCACTCGTTATAGTCGGTTAAGAGTCATTGCTGAACTTCGGCATGGGCATATGTATTTCCAGGCCAA
TATTGTTTCAAGCATTGAATTTGATCGGGATGATGAGTTGTTTGCTACTGCTGGAGTTTCACGGCGTATAAAAGTTTTTGACTTCTCTTCAGTTG
TAAATGAACCTGCAGATGCACACTGCCCTGTTGTTGAAATGTCTACCCGATCTAAGCTGAGCTGCTTGAGTTGGAATAAGTATACCAAGAACCAC
ATAGCTAGTAGTGATTATGATGGAATAGTAACTGTATGGGATGTGACGACTAGACAGAGTGTGATGGAATATGAAGAGCATGAGAAACGGGCTTG
GAGTGATGATTTTTCACGCACAGAACCCTCGATGCTTGTATCTGGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378195] SGN-U579490 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1620 [Download] [View] Facility Assigned ID: TUS34A2.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5