EST details — SGN-E378230

Search information 
Request: 378230Match: SGN-E378230
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184720Clone name: TUS-45-I6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184720 is on microarray TOM1 spot ID 1-1-3.1.14.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C83841 [cLET-26-F21] Trace: SGN-T108870 EST: SGN-E296818 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378230Length: 375 bp (1099 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378230 [] (trimmed) GTTCAGGGAGAAGAAGGCGACATCTATTATCAAGGTCTTCGACCATGCTGTTGGAATCATATGTGTCCATGAAGCTGGAGGGAAGGTGACTGACT
GGGAAGGAAGTTCACTTGATTTTGCAGCAGATCAAACTGAACGGAGACTCATCTTTCCTTCAGGCGGTGTTCTTGTGACTAATGGGAGCTTACAT
AGCAAGATTATCGAAATGATCTCTTCAAATTCATCAGTTCTTTGACAGGCTTTTGGCATTATTGTGACAAAATCAATAGTCAGATACTAATGAAG
ATTTCCTCCATTCATCATTTGTTTAATGACACTTGCATTCTTTTGACGAATCACAGCATATAGAAGTATACATATCAATGTCTCTCCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378230] SGN-U568173 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1846 [Download] [View] Facility Assigned ID: TUS45I6.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0140 Quality Trim Threshold: 14.5