EST details — SGN-E378246

Search information 
Request: 378246Match: SGN-E378246
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174155Clone name: TUS-18-A1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174155 is on microarray TOM1 spot ID 1-1-8.1.16.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7119 [cLEC-37-N24] Trace: SGN-T31294 EST: SGN-E208303 Direction: 5' Facility: TIGR
Clone: SGN-C174155 [TUS-18-A1] Trace: SGN-T199843 EST: SGN-E398517 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378246Length: 526 bp (1392 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378246 [] (trimmed) TTCACGAGGAGATGGGGAGAGTGGTTTGCTTTTGTTTGAGCAGATGAGAAAACTTAGACGGTTGGAGCCCAATGGGGACACTTTTTCCGTGGTGC
TTTCAGCCTGTGCTAGTAAGGGGTATGTGAAAGAAGGTTTTACGTATTTTGAGCTAATGAAGAATGAATATGGCATTGTTCCTGGAGTTGAGCAT
TACTTAGGGATCGCTGATGTTTTGGGAAAATCTGGGCATTTGAATGAATTGCTAGAGTTTATTGAAGACATGCCTATTGAGCCTACAAAAGTAGT
ATGGGAGGCCGTGATAAATTTTGCACGAATTCATGGGGATATTGAACTTGAAGATCGAACGGAGGAGCTGCTCATTATGTTAGATTCTTCCAGAA
ATATGGCTGATAAGCCGGTTGCACCATTTCAGAAAAGGCATTCTGAGTTTAATATGCTTGAGGGTAAAGACAGAGTTAATGAGGTTCAGAGCACA
ATTCCACATAGGGCAGATGCATATGAAAAATTGGAAAGGCTTAAGCCGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378246] SGN-U581772 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1306 [Download] [View] Facility Assigned ID: TUS18A1.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5