EST details — SGN-E378322

Search information 
Request: 378322Match: SGN-E378322
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184582Clone name: TUS-45-C12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184582 is on microarray TOM1 spot ID 1-1-5.3.14.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184582 [TUS-45-C12] Trace: SGN-T196538 EST: SGN-E395212 Direction: 5' Facility: INRA
Clone: SGN-C184582 [TUS-45-C12] Trace: SGN-T198607 EST: SGN-E397281 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378322Length: 296 bp (1057 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378322 [] (trimmed) GTGAATCCTCTGGGCTCCAACAATATGTTTTTTCTCGCCGGCGCAGGGAATAGAGGTTTGGAGATTGAAGGAAAATTTGTGAAGTTTACTGCGAT
CGGTGTGTACTTGGAAGAGAGTGCTATTCCATTTCTAGCTGATAAATGGAAAGGGAAAAGCTCTGAGGAGTTGGAACATTCAGTCGAATTCTTCA
GGGATATCGTTACAGGTCCATTTGAGAAATTCACTCGAGTGACTATGATCTTGCCCTTGACGGGTAAGCAATACTCTGAGAAAGTAGCAGAAAAT
TGTGTTGCATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378322] SGN-U577427 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1834 [Download] [View] Facility Assigned ID: TUS45C12.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0032 Quality Trim Threshold: 20.5