Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E378390

Search information 
Request: 378390Match: SGN-E378390
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178159Clone name: TUS-28-G21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178159 is on microarray TOM1 spot ID 1-1-4.3.4.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178159 [TUS-28-G21] Trace: SGN-T183296 EST: SGN-E370369 Direction: 3' Facility: INRA
Clone: SGN-C178159 [TUS-28-G21] Trace: SGN-T183297 EST: SGN-E370370 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378390Length: 930 bp (1263 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378390 [] (trimmed) GGNGCTGAAGAAATTCAATACGCCTCTGACGCTCTTTATAAAGAAATTCTCATATTGATCTGCTAAAGACGACGCTGCTATTATTAACACTGTTC
ATTGGTTTATCTCTGTTGTTTCGCAATTTTGCCGTTTTGTATTTGATAGAGTAATTCTCTTTTTTCTGTATCTATGGATGCAGGGAGCAGATACA
ATAAGTTTCGACCTCCTCTCGTTAATCAGATGTCTCACAAGAAAAGAACTCGAGAGAATCTGGACAGGTTTATACCCAATCGTTCTGCGATGGAT
TTTGACTATGCACATTACATGCTCAGTGGTGGGAAGGTTAAAAAGGAACACTATGGAGTAAATTCTCCATCTAAAGAAGCTTACTCGAAGCAGTT
AGCAGAAATTTTCAACATGAACAGAACGAGGATCCTTGCTTTTAAGAATAAGCCTCCACATTCGGCTGAGAGAGTTTCTGAATCTCCATCATCTA
TACAACAGCCAAAAACCGTTAAAAAGAGGAGATACATTCCCCAATCTTCGGAGAGGACCCTGGATGCTCCTGACATCCTAGATGACTTTTATCTC
AATTTGTTAGACTGGGGAAGCAATAACGTAATTGCCATTGCCTTAGGAAATTCTGTATATCTATGGGATGCTTCTGATGGGTCTGTTACTGAGCT
TCTCACGGTTGATGATGATTTTGGGCCGGTGACTGCTGTCAGCTGGTCACCAGATGGAAGAAGCCTTGCAGTGGGCTTGAATAATTCACACGTTC
AGCTGTGGAACACCTTGCAGGGATCTAGCCGATTGCTGAGGACTTTACAAGGACACAGATTAAGGGTTGGCTCACTCGATTGGAATGGACACATA
CTGACAACTGGGGGCATGGACGGTATGATCATCAACAATGACGTGCGTATAAGATCTCCATAGTTGGAACATATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378390] SGN-U571433 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1479 [Download] [View] Facility Assigned ID: TUS28G21.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5