EST details — SGN-E378580

Search information 
Request: 378580Match: SGN-E378580
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180878Clone name: TUS-35-I4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180878 is on microarray TOM1 spot ID 1-1-5.1.17.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64340 [cLEM-5-N24] Trace: SGN-T85295 EST: SGN-E271490 Direction: 5' Facility: TIGR
Clone: SGN-C180878 [TUS-35-I4] Trace: SGN-T193633 EST: SGN-E392307 Direction: 3' Facility: INRA
Clone: SGN-C180878 [TUS-35-I4] Trace: SGN-T193634 EST: SGN-E392308 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378580Length: 929 bp (1145 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378580 [] (trimmed) GATCCCCCGGGCCTGCAGAATTCGGAACGAGGAAAAATTTGTAAGCGGAGATTTCTGGCAGAAACGATGGAAGTGGAAGTGGAAGCTGCGGCGGC
GGCAGAGAGAGAAGCAACCAACAGTGTCATATGTCAGTTGGCTGACCCAGAAGGGAATCCGTTGGGTGCTGCCTTGTACCTCCCTGAAAACGCTA
GTCCAAAAGAGCTTAATCAAGTTGTCAATAAGCTTCTCAGCAATGAGGAAAAGTTGCCTTATGCATTTTATATCTCAGATGAAGAGCTTGTGGTG
CAGCTTGGATCATACTTAGAGAAGAATAAAGTGTCTGTGGAAAAAGTCTTGACCATAGTTTATCAACCACAAGCAGTGTTTCGAATCCGCCCTGT
CACTCGTTGTTCGGCCACAATTGCTGGTCATACTGAAGCTGTTCTTTCAGTTGCCTTCAGTCCTGATGGACGACAGTTGGCAAGTGGATCTGGTG
ACACTACAGTTCGTTTGTGGGATCTAAATACCCAGACACCGTTGTTTACATGTCAAGGGCACAGAAATTGGGTTCTTTCTGTTGCATGGTCGCCA
GATGGTAAGCATCTTGTTAGTGGAAGCAAGGCTGGAGAACTTATCTGTTGGGACCTTCAGACTGGGAAGCCTTTAGGGAATCCGCTTACTGGCCA
CAAGAAATGGATAACTGGTATTTCTTGGGAACCTGTACACCTCAGTGCTCCATGTCGCCGCTTTGTAAGTGCAAGTAAGATGGCGATGCACGGAT
ATGGGATGTTACCACAAGGAAGTGTCTCATTTGTCTCACTGGCCATACACTTGCAATAACATGTGTAAAATGGGGTGGAGATGGGAGTATATACA
CGGGATCTCAAGACTGTACAATCAAGGTATGGGAAACCACGCAAGGGAAGCTGATACGTGAATTGAAGGGTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378580] SGN-U569420 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1651 [Download] [View] Facility Assigned ID: TUS35I4.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5