EST details — SGN-E378610

Search information 
Request: 378610Match: SGN-E378610
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182617Clone name: TUS-40-A15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182617 is on microarray TOM1 spot ID 1-1-2.1.5.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182617 [TUS-40-A15] Trace: SGN-T191565 EST: SGN-E390239 Direction: 5' Facility: INRA
Clone: SGN-C182617 [TUS-40-A15] Trace: SGN-T191787 EST: SGN-E390461 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378610Length: 426 bp (1139 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378610 [] (trimmed) AGGCACTAACAGCTTTAGCTAATGTAAAGACCCTTGAAACAAGTTTTATTAGGGATGAAGAAGAACGTCCAAAAGTTGCTTACAATAAATTTAGT
GACGAAATTCCAGTAATATCGTTGCAAGGTATTGATGATGTTAATGGAAGAAGAAGTGAAATATGTGAGAGAATCGTAAATGCTTGTGAAGATTG
GGGTGTTTTTCAGGTAATTGATCATGGGGTTGATGCTCAATTAATATCACAAATGACAAAATTAGCGAAGGAATTTTTCGAATTGCCTCCTGAGG
AAAAGCTTCGGTTTGACATGTCTGGTGGCAAGAAAGGTGGCTTCATTGTCTCAAGCCACTTACAGGGTGAAGTGGTTCAAGACTGGCGTGAAATA
GTGACTTACTTTTCATCCCCCATTCGAGCTAGAGACTATTCTAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378610] SGN-U563669 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1736 [Download] [View] Facility Assigned ID: TUS40A15.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0056 Quality Trim Threshold: 14.5