EST details — SGN-E378622

Search information 
Request: 378622Match: SGN-E378622
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183871Clone name: TUS-43-E21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183871 is on microarray TOM1 spot ID 1-1-4.1.18.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10778 [cLEC-6-E10] Trace: SGN-T23953 EST: SGN-E202292 Direction: 5' Facility: TIGR
Clone: SGN-C183871 [TUS-43-E21] Trace: SGN-T196227 EST: SGN-E394901 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378622Length: 310 bp (1174 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378622 [] (trimmed) AAATGGACATACTTGAGCTGTTGTAGAGATTTTGAAACATTTGGACCTTCAAGTTGCTTCTCTTGTTGCAAATAATGGATATGATGCATTCCAAG
TTGCAGCAAAGCAAGGTCAGGGTGAAGTACTGAAGGAACTATTGCATTCGTTTCCAAACTTGGTTATGGCTACAGATTCATCCAATTCTACAGCC
TTACATACAGCAGCTGCCCAGGGTCATGTTGATGTCGTAAATCTGCTTCTGGAGATTGATTCGAAACTTGTTAAGATAGCTCGGGACAATGGGAA
AACTGTGGCTCCATAAGCAGCAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378622] SGN-U586261 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1785 [Download] [View] Facility Assigned ID: TUS43E21.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0079 Quality Trim Threshold: 20.5