EST details — SGN-E378639

Search information 
Request: 378639Match: SGN-E378639
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184912Clone name: TUS-46-A6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184912 is on microarray TOM1 spot ID 1-1-3.1.12.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17333 [cLED-19-F23] Trace: SGN-T53450 EST: SGN-E237536 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378639Length: 293 bp (1095 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378639 [] (trimmed) TTCATTAAGCAAGCACAACAATATTCAAAGGGTAGGCCAAGTTACCCTCAAGAATTATTCAATTTCATTGCTTCTAAAACACCTTCTCATGATCT
TGTTTGGGATGTTGGTACTGGTAGTGGCCAGGCTGCTCAATCTTTAGCTAAGCTTTACAAGAATGTGATAGCTACAGACACAAGTCCAAAGCAGC
TTGAATTTGCAGCNAAGGTTCCAATGTTCATACATATGTACCTCTCCTAAGTTGTCAAAATCCGAAATCGAAACAAAATAGGATCAGAATCAAGT
GTAGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378639] SGN-U580752 Tomato 200607 Build 2 98 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1856 [Download] [View] Facility Assigned ID: TUS46A6.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0148 Quality Trim Threshold: 20.5