EST details — SGN-E378883

Search information 
Request: 378883Match: SGN-E378883
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168717Clone name: TUS-3-N11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7698 [cLEC-39-O13] Trace: SGN-T31920 EST: SGN-E208630 Direction: 5' Facility: TIGR
Clone: SGN-C168717 [TUS-3-N11] Trace: SGN-T625 EST: SGN-E379536 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378883Length: 758 bp (802 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E378883 [] (trimmed) GAACTTATATTTACTGCGGATATTCCTTATCCCAGACAGTTATATGAACATTTTCATAGACTTATATATATAGTTGCATCTCATTTGCTGTCTTC
TACTCTGTTACTCTCAGTTGTTGAGGTAATTCTTGCTTCTCCGACGATAAAGAATGGGCTTGCTAACTGGTATGATTTCCATCTTTCACAATTAG
ATTAGTCAGTAGTTCTTCACTTTGCTGGACTCCCAGTTCATCTGATAATTTATTACACAACTGTCTATATACTGCAGAATCCCCGGAAGATTTCT
GTAACTCTACAACATACAAGGATGTACTAATCTCGAAAACCTCTACTACTATTGAAAGACTTGCTTGTGTTTTTTGACCTTTGTTCTCTAGCAAT
ACTTTTAACTTTCCAGGTTTTTTCTGGACTTGAAATCCCATTTGAACAGCTAGATTCTCAATCCTATCTAGCAGTTCTTTTGGAGAGAGATTAGA
TGTGAACCTGATCTTCCTCTCAGAAACATCCTCATTTTCAAAAAATCCAGATAGATCAAGGCATGAGGACATTCCTATAAGTTGAAAGGCATTAT
TGATGACAGAAGGTGATTCTGGATTTCTTTCTATGTCAAGTGGTGCTTCATGTATTGTCAACACTTCATCATCTGAGGATGTATCATCACTTTCC
ACTTCTTCTTCATCAGGATTTGTAGGAGTATAGTTTTGTTTAAACCATTCATCTTCTTTAATCTCTGCCATTGTTATTCTAGTTTGTGGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378883] SGN-U567122 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1011 [Download] [View] Facility Assigned ID: 240_F11_TUS03N11.Td_091.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0027 Quality Trim Threshold: 20.5