Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E378885

Search information 
Request: 378885Match: SGN-E378885
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168741Clone name: TUS-3-O11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6252 [cLEC-34-N5] Trace: SGN-T30403 EST: SGN-E207959 Direction: 5' Facility: TIGR
Clone: SGN-C168741 [TUS-3-O11] Trace: SGN-T637 EST: SGN-E379389 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378885Length: 678 bp (798 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E378885 [] (trimmed) TAAGTTTCCAAATCACCAAGCAGAAAATCAACAGATAAAAAGTATCACCCTAAACTGCAACCATCAAATTATAAGAAACTTTACACTTTACCTCT
AAGGTTGAGAAGGACTCTTTAATGGAAGGAACTTCTTCCGTAAGAGAACACATGAGAAGGCAAATGGAATTGCAACCATGGACTTAAGAAAACGT
TCAGCAGGACCGAGCTGAGAAATGTCTCCAGCAAATACTCTCTTGAGTTTTAGTTCTTCATCTGTTTGTTGGTGCCATCTTCAAGAGAGTTCGTC
TGAGTTCAGGAGGCAGCTCATTACCCTCATCAAGAGCATCATAAAGTTCTGTTGTCACATTTAAGGCTTTGAGGAGAATTGCTAGATTTTGTGAT
TTCTTAGGATCAACAATCTGAATGTACTGTGAGGTTTGATCAAAGGATGAGGAAACTTTTATAAGATCATCTTTCCCTTGGTCTACTGGTATATA
TCCAAACAAAGAATCCATCATCTCGTCATTAAACCTGTCATAAAATTCAGCAATCAGAATGGTAAAACAGAAAAAGTTCAACTCTTGCAGGAGCG
AAGTGAATAGCAAGATCAGTGCGAAGTTTACTGGAACGAGCGACTTTTATTTTCAGCCAAACCATAAAGTGGTCAGGGTTAGCAAGAAACTTGTC
CCAAAAGAATGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378885] SGN-U572577 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1023 [Download] [View] Facility Assigned ID: 240_G11_TUS03O11.Td_084.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0019 Quality Trim Threshold: 20.5