EST details — SGN-E378926

Search information 
Request: 378926Match: SGN-E378926
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168397Clone name: TUS-3-A3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5446 [cLEC-31-O20] Trace: SGN-T29702 EST: SGN-E206736 Direction: 5' Facility: TIGR
Clone: SGN-C168397 [TUS-3-A3] Trace: SGN-T789 EST: SGN-E379406 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378926Length: 703 bp (808 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378926 [] (trimmed) GTTATACTTCCACTTGCCCTTCGATAATCTCAGAGTTTCATCCGGAAACGCTTTCCATTCCAACCGCCGCTATGCCGCTGTCCGGCGACGGAGCT
GATGTCTCTGCCGGTGGACGATGTACGTGCTCTTCCCTCGATGAGGAAAGCCTAATCCAGAACTGCCAGCATTGCCGGCGATCGACTCTCCCTTC
CTCTTCGTCATCTTGCTCTTTGCTTAGCCTCGAATCTTATCCGGTTCAGGATTACGACAAGCTTTGGAGAATATTTAGTGCTTCCGTTAAAGGAT
TCACTATTGGCGCTGGTCTAAAAGGTGGCCTCGCTATCTTTGCTGTTCTCTCTCGGCTACGACGTAGGAAATCGATGTCCTCTGCGAAGAAAGGG
CAAATGGTCTCGAGCAGGGATGATGTAGTTTTGGCACTAAAGGAAACTCTAAGATATGGTCTGTTCCTTGGCACTTTCTCTGGTACATTTGTATC
AGTTGATGAAATTGTGTCCGCTTGGGGAGGTCATCGAAGGACAGCTAAGTGGAGAGCATTGCTAGCGGGTGCAATTGCAGGGCCATCGTTGCTTC
TTACTGGTAATACACAGCACACGAGCTTGGCGGTTTACATTCTTGTGCGTGCGGCTGTGTTGGCATCCCGTTGTGGAATAAAAAGTAAGCGGTTT
GGGCGCATATGCAAGCCTTTAACTTGGGCTCATGGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378926] SGN-U583612 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T245 [Download] [View] Facility Assigned ID: 228_A03_TUS03A3.T3_019.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5