EST details — SGN-E378944

Search information 
Request: 378944Match: SGN-E378944
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167873Clone name: TUS-1-K7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C9313 [cLEC-5-G6] Trace: SGN-T23725 EST: SGN-E200890 Direction: 5' Facility: TIGR
Clone: SGN-C167873 [TUS-1-K7] Trace: SGN-T31 EST: SGN-E379469 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378944Length: 793 bp (814 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E378944 [] (trimmed) TTTCGATTTATCACAGATACAATAATATGTTTTACGAATATAAAAAGTTTTTCATGTCTTCCCATATAATGTTGTTTCAGAATCTAAAGGAGACC
ACTCTCCTCTCTCTGAATAATACAGAATAAACAGGGTATACTTGTAAAAGAAACTTTCATGCAGATACCAAGAAAGAAGGGACAGACACCATGCC
ATCACTTGGGTGGATGAGCTTGCGGTCTTGTTGGACAGGCAGCAGCCATGGTACGTAACCGTCTGGCAATTTCAGTGAAAGATGGGCGGATGGCA
GGATCTGGAGCCCAACACTGTTCCATGAGCATTCTCCACTCAGTGTCACAGAAGCTTGGCACAGGCGGTCTCAATGTGTTGTTGACAATACCACC
TATAATTGCTCCATAATGCATATTTGCATAAGGTTCTTCGCCAGTGAGGATTTCCCAGAGCACAATCCCAAAGGAAAAGACGTCGACCTTCTCGG
AAACCTTATTACTTCCACCATTCAATAGCTCTGGAGCCATCCATGGAAGCGTTCCCCTGACACCACCAGTAACCAAGGTATTTCTCTTGATTTTT
GACAGCCCAAAATCAGCCACCTTACAAATGGGTCGAGAAGGATCCTTTAAGTTGACAAGCAAATTGTCACATTTCAGAATCAAATGCACAATATT
CTTCGAGTGCAAATATTCCATTCCAAATGCNAGCATCCATTGCATTATGAGCCTCTTGCGACGATCAAGGTGTCTGTCCTTGNCAAGTAAACATG
CCTAAGAGACCATTCACCATGAACTCTGCTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378944] SGN-U577536 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T505 [Download] [View] Facility Assigned ID: 231_C07_TUS01K7.Td_049.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0108 Quality Trim Threshold: 20.5