EST details — SGN-E378973

Search information 
Request: 378973Match: SGN-E378973
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168553Clone name: TUS-3-G15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5793 [cLEC-33-B22] Trace: SGN-T30145 EST: SGN-E206873 Direction: 5' Facility: TIGR
Clone: SGN-C168553 [TUS-3-G15] Trace: SGN-T384 EST: SGN-E379712 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378973Length: 773 bp (787 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E378973 [] (trimmed) GTATATATAGGAGATTGGAATAAATCATAACTACAGATGGAAGAAGCCTATCATTTCCTTTGTACAAAATGATGTTTTCTTGCTAATATACCTTG
AGGATTGAAATATAAGATATTGCTACAAACAAACTAATATACAGGAAAAGCATGTAATCAATCATGTACAAGAAGGCAAGCATTAACACATACTA
AATACACTTACTTATCTTCAGCAGTAAAATCTGGTTCAGCTGGTTTCTGAAGCAAAATGGGTGATATCCTATCTGTCATCCTTGCTTTCTTGGCA
GTATTGTGCCGCAAAGCACGAAGTGCATTAGCAGCAAATCGTGATGCATAGATAGTAGCACCCAAACTTGGCGAGCTACCACCTCCCCTTGCTAA
TGCATCTTGTAATCTGTTTTCTTCTTCGCAAAGGGATTCCTCTAGCTTCTTCCTACAATGACGGCGCCATGCTGCTTGTATGAAGCAAGCCGCCC
AGGTTCTCCATTGCTGCGAGTAAAACCTAAAAGTATGGCGGAGTTGCTTGCTATGAAGTCTCCGGAACTGAGAGGCTACAAATTTCAAATCATCC
GCCACTAGAGCAAATGCTTCAACTTCTGAGAGTGCTTGGACAGTTCGGGTTGAGATTGGGAGGTTATTTGATGGATGAGGATCAAGAGCCCAAGT
AAGAAGCTCTTCTCCACAAAAATCACCAGCTTTTAGATAATCAGAGTTAAAAAACCCTGTCCTCCCTCCATTAGTCGTTACGGTCAATAGTTTGC
CCCGCATTATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378973] SGN-U583186 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T928 [Download] [View] Facility Assigned ID: 239_G03_TUS03G15.Td_022.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0033 Quality Trim Threshold: 20.5