EST details — SGN-E378987

Search information 
Request: 378987Match: SGN-E378987
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167751Clone name: TUS-1-F5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1000 [cLEC-10-G22] Trace: SGN-T24705 EST: SGN-E201118 Direction: 5' Facility: TIGR
Clone: SGN-C167751 [TUS-1-F5] Trace: SGN-T214 EST: SGN-E379628 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378987Length: 696 bp (803 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378987 [] (trimmed) TGGTTTTGTTCTGGGTACTGGAAAGATTTTGCTCAAGGTTCCTCCAACTATCAGATTTGTATTGGATGGTGAAATTCCGAATTACATACTAGCTA
AGGATTTGATTTTGCAAGTTATTGGTGAAATTTCTGTAGCTGGTGCAACATACAAAACAATGGAATTTGTCGGTACTGCTGTTGAAAGTTTAACA
ATGGAAGAGAGAATGACATTATGCAATATGGTTATCGAAGCTGGTGGAAAGAATGGTGTTATTCCTGCTGATAAAACAACATATGACTACCTTAA
GGACAAGACTACTGTGCATTATGAACCTGTCTACAGTGATGAGCAAGCCAGGTTTCTTGCTAAGTATCATTTCGACATCTCAAAGTTGGAGCCCT
TAGTAGCAAAGCCTCATTCTCCTGGCAATCGTGCTTTGGCAAGAGAATGCGAAGATGTTAAGATTGACAGAGTATATATTGGATCTTGTACCGGT
GGGAAAACAGAAGACTTCATGGCTGCTGCCAAAGTTTTTCTAGCATCAGGAAAGAAGGTCAAAGTTCCAACATTTCTCGTCCCTGCTACGCAGAA
GGTCTGGATGGATTTATATACTATCCCAGTTCCAGAATCTGGTGGCAAAACATGTCACAGATTTTCGAGGATGCTGGCTGCGATACACCAGCAAG
TCCTAGTTGTGGTGCTTGTATGGGTGGGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378987] SGN-U576272 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1156 [Download] [View] Facility Assigned ID: 243_F05_TUS01F5.T3_045.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5