Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E379027

Search information 
Request: 379027Match: SGN-E379027
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167812Clone name: TUS-1-H18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1042 [cLEC-10-J23] Trace: SGN-T24746 EST: SGN-E201159 Direction: 5' Facility: TIGR
Clone: SGN-C167812 [TUS-1-H18] Trace: SGN-T1253 EST: SGN-E379904 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379027Length: 796 bp (807 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379027 [] (trimmed) CAGCAACAAGCTGCAATAGTATCAAACAAGAGAAATACAAAAATTCCAAGGATCTTCCTCCTCACCTAGGGCCTGATAGGACCGAAGGCAGTAAA
GGAGCTGAATCTGCAAAACAGATATTTGGTATTGCGGAAACAGTTTGTGGTCTAAAGCTGTAGTCTAGATCCTTGTCAACATCTATAACACCCTC
CATGGCCTTGACCACCATCGACATTGATGGCCTCTTCGTGTAATCACTTTGTAAACACCAGGCAGCAATCTGCATTGCCTTGACTACTTCTTCTT
TGTAAAACTGCATATCTTCACTGTGCTTATCAATAAGATCAACCAACTGCCCTTCCTCTGCTTTTCTCCTGAATAAGTTCACCATTACCTGTTCG
TCTTCAGACTCCAATGCTTCAAAATGTCTTCTTCCACTCAAAATTTCCAAGATCACAATGCCAAAGCTATAGACGTCTACCTTCTCTGTTATAAC
TCCACTAAGCCATTCAGGAGCCAAATAACCAGGAGTGCCTCTCATCTGAGTCATAACTTGGCTCTGATTCCGATCAATTAGCTTTGAAAGCCCAA
AGTCAGCGAGTTTAGCATTGTACTTCTCATCCAGGAGTATGTTTGGGGGCTTAATATCCAAATGCAGAATCTTTTGCCTGCATTCTTCGTGAAGG
TAGGCTAATCCTTTGGCTATGTCTTGAATAATCTTCCTCCTGCAGTTCCAGTCTAGAGTTTGCTCCTGTTTCCCGTGGTAGATCCATTTTTCTAG
TGATCCGTTGCTCATGCACTCATATACTAAAAGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379027] SGN-U567149 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T475 [Download] [View] Facility Assigned ID: 230_H06_TUS01H18.Td_048.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0029 Quality Trim Threshold: 20.5