Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E379033

Search information 
Request: 379033Match: SGN-E379033
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168591Clone name: TUS-3-I5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5825 [cLEC-33-D4] Trace: SGN-T30148 EST: SGN-E206876 Direction: 5' Facility: TIGR
Clone: SGN-C168591 [TUS-3-I5] Trace: SGN-T951 EST: SGN-E379892 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379033Length: 729 bp (801 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E379033 [] (trimmed) GCGGCCGCTCTACACTAGTGGGATACCCCGGGCTGCAGGAATTCCGCACCAGGTGGTTTCTGCCCATTTAGATAGTGGAAGATCAGTAGATGAGC
AAGGCGTAGAAGAAGCTTTTGAACTTCTTTATGAGATAAATGAACGGGTCAGGACCGGAATTTGGGTTGGTGATTGCTTCATTTACAATAATTCT
TCCTGGAGACTTAACTACTGTGTTGGTGGTGAGGTGACCACAATGTTTCATTTAGACCGGCCTATGTACCTGCTCGGATATCTAGCAAACCAGAG
TAGGGTTTTTCTGATTGACAAAGAGTTCAATGTCATTGGATATACTTTGCTGCTCAGCCTGGTTGAGTACAAGACGCTTGTGATGCGTGGTGACT
GGGACAGAGCAAATGAGGTGCTGCCATCTATTCCTAAGGAGCACCATAATAGTGTTGCTCATTTCTTGGAGTCGCGAGGTATGGTAGAGGAAGCA
TTAGAAGTTGCAACAGAGCCTGACTACAGATTTGATCTAGCCATACAGCTGGGAAAATTAGAAATTGCAAAGGATATTGCAGTGGTCGCTCAAAG
TGAGTCCAAATGGAAGCAGTTGGGTGAACTAGCCATGTCTGATGGAATGCTGGAGATGGCAGAGGAATGTCTGAAGTATGCCAATGACTTGAGTG
GTCTGTTGCTACTCTATTCTTCACTAGGAGATGCTGAAGGCATAACTGAACTAGNCACTCTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379033] SGN-U585844 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T565 [Download] [View] Facility Assigned ID: 232_A05_TUS03I5.T3_024.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5