EST details — SGN-E379064

Search information 
Request: 379064Match: SGN-E379064
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167773Clone name: TUS-1-G3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C8194 [cLEC-4-L10] Trace: SGN-T24503 EST: SGN-E201553 Direction: 5' Facility: TIGR
Clone: SGN-C167773 [TUS-1-G3] Trace: SGN-T223 EST: SGN-E379089 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379064Length: 685 bp (784 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E379064 [] (trimmed) AATTGATTGAACAGCTTCCCAAGACAATTTGCAAAAGCATAAGGCACCATTTGTTTTTACCAACAGTGGAGAAAGTTTATCTTTTTAAAGGTGTC
ACAAAGGAAATTCTGTTACTTTTGGTTGCAGATATGAAGGCTGAGTACATACCTCCAAGAGAGGATGTAATAATGCAGAACGAATCACCAGACGA
GTTGTACATCATAGTGTCAGGGGAGGTGGAAATGATTGAATCTGAAATGGAGAATGAGCCAACTGTTTGGACTTTCAAATCTGGAGATATGATAG
GAGAAGTAGGGGCATTGTGTTGTAGACCTCAGAGCTACACGTATCGAACCAAAACACTTTCACAGCTCTTGAAGATAAGAACTAGTAATTTGATT
GAAGCAATGAAAACCAGACAAGAAGATAATATCATCATGATCAAGAACTTCCTTCAGCATCATAAGAAGCTCAAAGGCTTAAGGCTTGGAGATTT
ACTTCATGGAGTGGGGGGAGATTATGGTGATCCAAACATGTATGTTAACTTGCTAACTGTTGCTAGTACAGGTAATGCTACTTTCCTTGAAGAAC
TTCTCAAGGCTAAATTAGATCCTGATATCGGAGACGCTCAAGGAAGAACTCCACTGCACATTGCAGCATCGAAAGGGCATGAAGAGTGTGTCATG
CTGCTTCTTAGACATGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379064] SGN-U568026 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1165 [Download] [View] Facility Assigned ID: 243_G03_TUS01G3.T3_022.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5