Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E379071

Search information 
Request: 379071Match: SGN-E379071
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167769Clone name: TUS-1-F23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167769 [TUS-1-F23] Trace: SGN-T458 EST: SGN-E379369 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379071Length: 696 bp (803 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E379071 [] (trimmed) ACGGTCCAATTTGCTTCAAGGTTCACTACCTATTCCACCGAATTCTACCAGATACTTCTTAATATCCCAAAATAATCTCACCGAAGAAATTCCTC
CATCTATTTGCAATTTGACATCACTGATAATGCTAGATTTGGCTAGAAATAACTTGAAGGGAGCAATTCCGCAATGTTTGGGTAATATTAGTGGC
CTCGAGGTTTTGGATCTTCACAACAACAAACTTTCTGGGAATATTCCAACAATTTTCAGCAATGGAAGTTCACTGAGAAGCCTCAACTTGCACGG
AAATAAACTTGAGGGGAAAATTCCCCGATCTTTGGCTCATTGCAAAGACTTGCAGGTTCTTGATTTAGGAGATAATCATCTCATTGACACATTCC
CTATGTGGTTGGGAACTCTTCCAAAGCTACAAGTTTTAAGCTTGAGATCAAATACATTGCATGGGTCCATTCAACCTCCAAGGATCGAAACTATT
TTTTCCGAGCTTCAAATCATAGATCTCTCTTACAATGCCTTCTCAGGAAACTTACCTACGAGTTTGTTTCAACATCTGAAAGGCATGAGGACAAT
TGATTCATCAACAGAAGCACCAAGATATCGTGGAGATACATATTACCAAGATTCTATTACAGTTTCAACCAAGGGATTTATGCGTGAAATTGTGA
GGATCTTGTATTTGTACACCGTTATCGATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379071] SGN-U571492 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1236 [Download] [View] Facility Assigned ID: 244_F11_TUS01F23.T3_093.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0018 Quality Trim Threshold: 14.5