Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E379102

Search information 
Request: 379102Match: SGN-E379102
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168461Clone name: TUS-3-C19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168461 [TUS-3-C19] Trace: SGN-T890 EST: SGN-E379139 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379102Length: 710 bp (807 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E379102 [] (trimmed) TTTCTTTCTACTAGAAACGTCTGAAATTGCCAACTGTCTCTGCTCCTCACGCCACACACGGAGAGGCAAACACGCGGAGTTCTCTGTACTCAGTC
TCTTCGAGTCAGATCGAGTCAGCTGAAGATGCCTTCTCGCCGGCGAACGCTTTTGAAAGTCATCATCCTCGGCGATAGCGGGGTTGGAAAGACTT
CGTTGATGAATCAGTATCCTTTTAAGCTTTGTAACCTAGTATTGCTCGATTAATCACCAGTCCAAGAGTATTGTGAAAAAACAGTTTGATTCACT
TTCCAGATGCAATTATACCTTATAATTGAATTGCCTTATTGTCTGCCTTCAATGATTCTTTATAGATATGTAAATAAGAAGTTCAGCAATCAGTA
CAAAGCAACTATTGGAGCTGATTTCTTGACAAAGGAAGTGCAGTTTGAGGATCGGCTCTTTACTCTACAGATTTGGGACACTGCTGGCCAAGAGA
GATTTCAGAGTCTTGGTGTTGCTTTTTACCGCGGTGCTGATTGTTGTGTCCTTGTTTATGATGTAAATTCAATGAAGTCATTTGAAAACTTGAAC
AACTGGAGAGAAGAGTTCTTAATTCAGGCAAGCCCATCTGATCCAGAGAACTTCCCATTTGTCGTGCTGGGGAACNAAGTTGATGTTGATGGTGG
AAATAGTAGAGTGGTGTCTGAGAAAAAGGCTCGGGCCTGGTGCGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379102] SGN-U579092 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346 [Download] [View] Facility Assigned ID: 229_C07_TUS03C19.T3_051.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5