Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E379114

Search information 
Request: 379114Match: SGN-E379114
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167916Clone name: TUS-1-M2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14709 [cLEC-8-C22] Trace: SGN-T25162 EST: SGN-E200073 Direction: 5' Facility: TIGR
Clone: SGN-C167916 [TUS-1-M2] Trace: SGN-T48 EST: SGN-E379475 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379114Length: 708 bp (781 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379114 [] (trimmed) TAGTACATCATATAGGGACATAGGGTATTTACTGTGTTATGTTTTACCAATTGGAATTTATACGCAGTAAAACTTCCTTAAGTACCATATACTTA
CTATATAGAACATATAAAGGTAATTTAATTATCTTTATAATTGGATTATTTCTCGTTTTGTGCGTGTCGGGGTCATGCTAAAGGACATTTATCTC
GGCGATTTTAGTGATTCAACTTGAGATTTTCCTCTAGGTCCGTTTGTTCTAATGAAAGCTCGATACTCGTTGAACGTCGTCGGTAAATATAACGC
CGGCTGATCCTCCGTCACAAGTTCTTCAGCAGGTTGAATAAGGATGTCACCTCCTGGATTGTAGAAAAATGCTAAAGAGACACGTTCTTGCCCTG
AATTAACGATCACGCGATGCTCTATGCTTTTGTATATTGCATTGCTTAGTACCTAATACATGCAATAATTGCAAAAAAAAATAAAAATTCACTAT
CAATATACAAGTTATCGTTATTATTGACGAATTACCTAAGACGTTATGAATACTGACCTGAATTTGATCTCCAATATTAACGATAAAGGCATTAG
GAATCGGTTTAACCGTTATCCAGTCATCACCACGACGGACTTGGAGGCCGGGGACGTCGGTGTCGGGGAGGAGAAGGGTCATGCCACCAGGATCA
GAGTGGGAAGAGAGTCCCAGTGTTAGGTCAGGTTGGGGACATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379114] SGN-U564995 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T522 [Download] [View] Facility Assigned ID: 231_E02_TUS01M2.Td_007.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0043 Quality Trim Threshold: 20.5