EST details — SGN-E379146

Search information 
Request: 379146Match: SGN-E379146
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168665Clone name: TUS-3-L7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7573 [cLEC-39-H15] Trace: SGN-T31824 EST: SGN-E208534 Direction: 5' Facility: TIGR
Clone: SGN-C168665 [TUS-3-L7] Trace: SGN-T598 EST: SGN-E379386 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379146Length: 689 bp (795 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379146 [] (trimmed) AAGATAAACCAAATGACTCTTAACTGTGTCTTTTGCCACCGTCTGTCCAGCACCCAGTTCTGGGAAAGGATACCTGACATACAGGGCAGAAAACA
AGAACCAAACAACAACATAAAAGACTGAACATGAGCAGGAAGAGTAAAGTATAGCAAGTTTTCATAACACACTTTATTATAGTAGATACTGATAT
CTCTGGTAACTCCAGAGTTGAACTGCACTATTCATTTTTTCTTCTGAGCAGCCTTGGTGACCTTGGCTCCAGATGGGTCCTTCTTGTCAACATTC
TTGATAACACCAACAGCAACAGTTTGACGCATGTCCCTCACAGCAAAACGTCCCAATGGTGGGTACTCGGAGAATGTCTCAACAACCATGGGCTT
GGTGGGAATCATCTTAACCATACCAGCATCACCGTTCTTCAAGAACTTAGGCTCCTTCTCGAGTTCCTTACCAGAACGCCTGTCAATCTTAGTCA
AGATCTCAGCAAACTTGACAGCAATATGGGAGGTGTGACAGTCCAGCACTGGAGCATATCCATTTCCAATCTGTCCTGGATGGTTCATGATGATG
ACCTGAGCGGTGAAGCTAGCAGCCCCCTTAGCTGGGTCATCCTTGGAGTTGGAAGCCACAAATCCACGTTTAAGATCCTTAACCGCAACATTCTT
GACGNTTAAACCAACATTATCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379146] SGN-U580191 Tomato 200607 Build 2 66 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T984 [Download] [View] Facility Assigned ID: 240_D07_TUS03L7.Td_058.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0034 Quality Trim Threshold: 20.5