Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E379164

Search information 
Request: 379164Match: SGN-E379164
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167718Clone name: TUS-1-D20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14983 [cLEC-9-N5] Trace: SGN-T24994 EST: SGN-E200700 Direction: 5' Facility: TIGR
Clone: SGN-C167718 [TUS-1-D20] Trace: SGN-T436 EST: SGN-E379515 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379164Length: 674 bp (780 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E379164 [] (trimmed) AAAGCATGGATGAGAATACTGCTGAAGTGAACTCTAAGGAGGACTCTTCTCCTTCAAAGGCAGAAGTTCAGTCACGGCCCTGCAATGCAGAAGAT
TTTGCTACATGGCAACGAATAATTCGGCTTGATGCAGTTCGTGCTAACGCTGAATGGATAGCATACTCCCCATCTCAAGCTGTTGTATCAGAAAG
CAGGGCACACCGTTTTGCAGAGGCTGTTGGGTTGAAGGACTATGAACACCTAGAGCCCCCTAGGATCCTACATGCTGCTCGGCTAGTCTCCATTC
TTGAAGCCTATGCGCTATATGACCCTGAAATTGGTTATTGCCAGGGGATGAGCGATTTGCTGTCACCCATAATTTCTGTAATGACAGAGGACCAT
GAAGCTTTTTGGTGCTTTGTTGGTTTCATGACGAAGGCTAGGCATAACTTCAGGCTTGATGAGGTTGGAATCAGGAGGCAGCTGAACATTATTTC
TAAGATCATCAAACAAAAGGATTCACATCTCTATCGACACTTGGAGAAGCTCCAAGCAGAGGATTGCTTTTTTGTGTACAGAATGGTGGTAGTTC
TTTTCAGGCGGGAATTATCTTTTGAGCAAACGCTCTGCCTATGGGAAGTAATGTGGGCAGACCAGGCTGCTATTAGGGCTGGGATTTGGCAGTCT
GCCTGGAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379164] SGN-U567837 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1214 [Download] [View] Facility Assigned ID: 244_D08_TUS01D20.T3_064.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5