EST details — SGN-E379196

Search information 
Request: 379196Match: SGN-E379196
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167850Clone name: TUS-1-J8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167850 [TUS-1-J8] Trace: SGN-T21 EST: SGN-E379468 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379196Length: 683 bp (815 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379196 [] (trimmed) ATGTATATTTCCACGATAGTTATGACTCTTTAGTACAGATATAACTTCAAAATTCTGATCAAATTCGATGCGATAATACAGGTATGATAACATCC
TATTTTCAGAAACCAAGCAACTAGGGTATGTTATGCATGGATGTTTGGTTGTATACAAGACTCCAAAATTTTATTAAATACATTTTCATGACGAC
TCTGCTGGGAAAGAAAGAGCCCCCATTATTGCAAGAGCTAAATTAGAACACATAACACTCAGCTAGCTAGCTAGCTATTATACTAAGAATGGTGA
TGTTGGCTTCTGAAACTCCCAAGAAAAGAAGCCATAGATACGTCAGATAAAGGTTAAGCTGGGGAGAACGCGTTGCACAATGACTTGTATGCAGT
GACACAAGTTTTGAATTTCTCTTCTGCTGCTGCCTGTGAAGGGCCTTGATGTTTATCAGGATGCCACTTTAATGCTGATAAGCGGAAAGCATTCT
TGACATCCTCAATCTTCAGAGGACCTCTTGGGGGCAAACCGAGAATTGTTCTTTCTGAGGAAGAACCTATATGACACGATTCATATTTGGATTCT
GTATGTGTCTCGTTTTCAGTTTCATTATCCCATCTGTAATGCCTTTGTTCTGACCAGTCTGTTTCTTGTCTTCGGGAGAACATATCTTNCAAAGT
AGATGATTTACCAGGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379196] SGN-U583864 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T495 [Download] [View] Facility Assigned ID: 231_B08_TUS01J8.Td_060.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0074 Quality Trim Threshold: 20.5