EST details — SGN-E379203

Search information 
Request: 379203Match: SGN-E379203
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168637Clone name: TUS-3-K3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5937 [cLEC-33-L16] Trace: SGN-T30291 EST: SGN-E207019 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379203Length: 691 bp (798 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E379203 [] (trimmed) CTAAAATTAACTTGACCCAACGATTATTGACCAACATATAATGTGAAATACATTGAACAATTGATCTGGTTGAATTAGATCAGTTGGTTGAATTC
TTACCTCAAACGCAATATTATATAAAAACCATTAAATTAGGAGCACACCACAAGGAGATGTCAAAGTTGAAATTAAACAACAAAAAGAGGGACTT
ATTGCAAAACAAATCGAAAGCGGTTAGGCAGGAAGCTTAGAAGCTTCGAGATCAGCAGCTTGCTTAATCAAACTCTGTTCACTATCATCAAGCGC
CATTTGAATCGGCGATGAACCAAGTCCATCAGCGATCGCCAGCATAATTTTCCTCATCTCGTTCCCAAATTCCTCTCGGTCGACAGTGCCGTTGT
GGTCGCAATCGAACTTCTCGAAAATGGAATCGTAGAGGTCGGTGAGTTCCTCCGGCGTGGCGGCGACGTCGACGCCGAAGTGAGATTCAATGAGA
TGGAGAGATTCGAAGGCTTTGCGGAGCTCGGATCGTGACAAAACGCCGTCGTTATTGAGGTCCAAATCGGTAAATCCCTTATCAATTGACTTTGT
GAAAGCCGCTTCGTCGTTGACGAAATCTCGAATTGTTGATCCGTCGATAATCACCACTCCCATTTTTGTTTAATTTTTTTGACTGTTTGAGAAAT
TGTTTCTTATGATTATGTGGNACTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379203] SGN-U568465 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T584 [Download] [View] Facility Assigned ID: 232_C03_TUS03K3.T3_017.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5