Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E379213

Search information 
Request: 379213Match: SGN-E379213
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168720Clone name: TUS-3-N14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379213Length: 551 bp (792 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E379213 [] (trimmed) CTCGCCGGCTTCAGCTCCAACTCTGGGTGATTTCATTGATGAACCTCTTGAAAAGAATGGTGGTGTCATGGTGAAAATCCACCGGTCCGATTTCG
GTTCCGGTTCAGACCACTCCATCCTTTTGTTAGATCTAGAACCCCGGTTGCTTCCATCTCCGGTACCGGTTCTGTATCCTTTTCTGGAGCTTGTA
TCTCTTGGTAAGGTGCCTCCAAAGCTTTTAGCCCGGTTCAATAGTGCACGGTTCATTACCTCTTTCCGAACGCCCTCCGGCAATCTGAGAGTGTA
CCGGTCTAAATTCTCACCTGGTAGTACTAGTGAATGACCGGTTGAATGTGATCTGAATTTGCTGAACATCTTTGGCCTCATGGAAATTGATCTCG
GTGGTTGAATCGGCACGTTGAAACTCAAGTTTCTCTTTACTCCTGATTTAACTGAACCGCCTTCTTCTTGCTTGGGAACCCGGTTCGGCACGTTG
AAGCTCAAATTCCGCTTCACCGTCGAATTAACAGAACCTTCTTCTTGTTGCTGTTGCTGTACTTGTTCCCTTTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379213] SGN-U572830 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T761 [Download] [View] Facility Assigned ID: 234_F02_TUS03N14.T3_025.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0026 Quality Trim Threshold: 20.5