EST details — SGN-E379436

Search information 
Request: 379436Match: SGN-E379436
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168602Clone name: TUS-3-I16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6795 [cLEC-36-M23] Trace: SGN-T31066 EST: SGN-E207478 Direction: 5' Facility: TIGR
Clone: SGN-C168602 [TUS-3-I16] Trace: SGN-T726 EST: SGN-E380039 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379436Length: 773 bp (786 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379436 [] (trimmed) AACACTATCACTAATTTGAGCTTATGACATTTTACCTCAACAAAAATCGATATACATTTCTTAAATATCAAAAGAAAGATATAATACAAAGCAAC
AATTCTGTTCACTCTCCTTGGTGTCAAATTTTAGAAAAGAATTTTCTCCATTTCAAGCATATAAGTAAAGCATCAGATAGTTCAAAACTGCGATA
CTCACTAGTGAGTCGCGGTCCAACAAAATGATCGACGATGAAGCTTTAACTTGAGCTACCATTTCTATTCATCACATCATGGTAATACAGAAGCA
CACACATTGGTTGACCAACAATGCAGAAAAAGCACCAGAATGTCATGTTGTCCACATTCGAGTTTTTGAACTTGTTTTGCAGGAAGTTCGTTAGT
ATGACCAAGGGAATCTGAAACATGATTCCAAGGAATGCCCAAAACTTGAATAGCCGACAAGGAACAGCAATACACAGCTCATGGAAAACAGCAGA
TATAAAGAAAGAGATCACCATTGCAACTCCCTTAGGTATGCCATTTCTTAAGCATGGGAAATAGATGTGACGAACCATCCACTTATGTACAGGCA
TATTCCAAAGTCTCCAATACTCATCAATTGTTTTTGCGTTCCACCAATCTTTATAGAACTCACGATCCCCAAATCGCAGAACTTCCGCAAGTATA
TTTAACCAAAGATGAAAGAGGCTGTAGAACATGCAGAGCCAGACATATAAAATTGGAAACTGAAGCTTCAATACCCTCTCGATGGCGTATAAAAG
GTTTCCTTCAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379436] SGN-U564273 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1036 [Download] [View] Facility Assigned ID: 241_A04_TUS03I16.Td_022.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0067 Quality Trim Threshold: 20.5