Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E379476

Search information 
Request: 379476Match: SGN-E379476
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167925Clone name: TUS-1-M11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C9383 [cLEC-5-L2] Trace: SGN-T23877 EST: SGN-E201042 Direction: 5' Facility: TIGR
Clone: SGN-C167925 [TUS-1-M11] Trace: SGN-T530 EST: SGN-E379648 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379476Length: 647 bp (808 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E379476 [] (trimmed) CTCAGATGAACCCTGAGTAATACACAAAAAATGTCTAAAGGAAACTCTCATCTTAAATACATTACATTAATCCTTCAAATCATCTTTCTGCAAAC
ATCCAATGCTTGGAAGATTAACTGTCCTGATTCTGCCTGTGGCGATATCCGTAGCATAAAACACCCTTTTTGTTTAAACACTGATCCAAAACATT
GTCGTGTTTTTTCAGGATTTGAATTAGCTTGTGAAGGTAACCAAACCGCTAAATGGTCATCCTCCAAGAAGTTTCACGATCAAGGCATCGACTAT
GCTAATAACACAATTCATTTGGTAGATCCGACTTTACAAACACATGATCTATGCTCTCTCCCACCTTCTAAGCTTAACTTTCACCAATACAATAA
TTTCTTCTATGAATACAATTGGTATAGAGAACCCACGCCCATTTTCATGTTCAATTGTCCATTTGGTGTTGATGATTCGACATTTGTGGAAATTA
ACGGCTGCGAATCAAGCAAATACACTTACCTAAAGATTGGAGAAATGAAAGTCTCTCAAGTGAGTGATGGATGCATAGCGGAGTTTATAGGCTTA
ACCTCATGGCCTAATATTAACAACATTTCCTATTCTAATATTCATCAAGCAATTCTCTACGGATTTGAGTTTCCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379476] SGN-U575322 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56 [Download] [View] Facility Assigned ID: 222_E11_TUS01M11.T3_068.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5