EST details — SGN-E379572

Search information 
Request: 379572Match: SGN-E379572
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168550Clone name: TUS-3-G12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379572Length: 483 bp (806 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E379572 [] (trimmed) ACTTGAGGAAGCTAACATATGTTCATCTCAATTTAGCAGGCAACCTTCATTTTGTTTCTATCAATTTCAGTTGCAGATTCCAACATTTTCGAGTT
GATTTTTCAGATGGTCACGTAACCTTCCTAGCAAGGGTTAGGCTTAAATCTATAATTAAAATATATTATTTAAGTAAATATTATTAAATTCGATC
GTACTCGTATCTGGACTCTAATTCTGCCCTGCTACCTCATAGATTAATAATAATACAAATACATGTTATAAGAGGTAGCCTTAATAAAATTTGAC
AAATTTTATTTCCTCACTTGGGATTACGATGCTACAACTAGGGTTCCACATAAAGAAAGAATGAAATTGAAAAAAAATCACTGTGTATAACTAAG
TAAACCATGTAAAATGACGCGCTTATATATTATGCCTTACGAATTTCAGCGCGGATAACCAGGTGGAGGATATCCAACACCACTTGGTGCATAAT
TGGGTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379572] SGN-U574164 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T860 [Download] [View] Facility Assigned ID: 237_G12_TUS03G12.Td_098.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0124 Quality Trim Threshold: 20.5