Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E379841

Search information 
Request: 379841Match: SGN-E379841
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167835Clone name: TUS-1-I17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167835 [TUS-1-I17] Trace: SGN-T651 EST: SGN-E379729 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379841Length: 728 bp (783 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E379841 [] (trimmed) GCGGCCGCTCTATTACTAGTGGACGAACGGGCTGCAGGAATTCTCCACGAGGGGAAATCGCCTAAATGGTTCAATTCCAAGCTATTTATTTCATT
GGAAGAATTTAACATCTCTTCTTTTGGGGGATAACCAATTTTCCGGGAATTTACCTAGTATAACTGGAAATTTGAGATTAAGAACATTGGATCTT
TCGTCGAATCAGCTTTCTGGACATATTCCAAAAGAATATGACAAGAAAGAATACAACTTTAGAAATAATCTGAATCTGTGTAGCAAATATACCAA
CCATTACATCCAGGTTCCACGTTGCAGTGGAAAAACAAGAGTTGTAATTGCTGTTGTGGCCCCTGTTGCATTTTTAGTCATGGTAACATTGCTAT
GTTATACATGTAAAAAGAATTGGTCTTTCTCCACAGACCAACTCATGCGGAGGAAGAAGAGGCATGAGAACCAAGACCCTGAGTGGATGTTCATT
TCTTTCCAGCAGCTACGATTCACAGAATCCGAAATTCTGGTGAATATGACGGAAGAAAATTTGATTGGAAGTGGAGGATGCGGGAAGGTCTATCG
AGTTGGTGTCAATCCGAATGGGAACTTTGTGGCAGTTAAGAGAATATGGAACAAGAGGAATTTAGATTACGGACTTGAGAAACAGTCCTTGCAGA
AGTTGAAGTATTGGGTAGCATTCGACATTCTAACATTGTGAAGTTATTTATGTGCATTTCTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379841] SGN-U575472 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89 [Download] [View] Facility Assigned ID: 225_A05_TUS01I17.T3_035.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5