EST details — SGN-E379857

Search information 
Request: 379857Match: SGN-E379857
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168457Clone name: TUS-3-C15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168457 [TUS-3-C15] Trace: SGN-T886 EST: SGN-E379138 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379857Length: 710 bp (797 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E379857 [] (trimmed) ATGATATATTCTCCGAATTCTTTGGGTTTTCCACCCCGTATGGTGGGATGGGAGATATGGGTGGACGGGCTGGTGGTCCAAGTTTCAGTAGAGGT
ATGTTTGGGGAAGATATTTTCACTTCATTCAGGAATGCTGCTGGCGAAGGTGCATCAGGTAATGCTCCACGAAAGGCCGCTCCTATAGAGCGGGC
ACTTCCTTGTAGTTTGGAGGATCTATACAAGGGAACCACCAAGAAGATGAAGATATCCAGAGAAGTTACTGATGCTACTGGATGACTACTTCAGT
GAAATGATACCAGTGATTCGTTCAAACTCTGAAGCAAACAAAACCTGGTACTTGGGTGGGTAGGAGGATATAGAAGCAGCCTCATTATCGCCGAG
TTTCGAACTGTGTGCCACAGGCATTTCTCCTATATGTGTTTTTATGAGTGTGTCGATTCATGTCAATTTTCTTTTGTTTCTCTCTCTTTTTCAAC
CCAATCACTGTGAAGTTTTTGTTTCTCAAATTGCGAAGTGCTTTCTGCTACTTTTGGAAGAAGCAACAGGTCCTTGGATTCCTGCTGGTGAAGCA
CTTGATGTTTTAAAATGTTGTGTTGTATTTTTTNCATTTCCTTTAATAATATTTCCGATTGTTTACTAGTAGAAGTTTCTAATCCCGTTCACNAT
GTTGTTACTACAGGAGACCCAGTACAACAGAGGAAATTCTAACGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379857] SGN-U569322 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342 [Download] [View] Facility Assigned ID: 229_C03_TUS03C15.T3_020.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5