EST details — SGN-E380000

Search information 
Request: 380000Match: SGN-E380000
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167678Clone name: TUS-1-C4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167678 [TUS-1-C4] Trace: SGN-T1127 EST: SGN-E379979 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E380000Length: 722 bp (788 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E380000 [] (trimmed) TGCATAAGTAGCTCAAATCGGAAACTTGGATTAATCTCCAAGACTCTTTCTCAACAAAAAGCAGAACATAATACTTCAAAAACTAGGATGTAATG
TAACAAAAGTTCAAATTTTTACTCACTCCAGTACTTCTCTTCACCATCTTTATGATCTTTTTGATCTTCAAATCCTTTATCCAAACTCATCTTAA
ACTTGTTCACATCCTCCACAGCTGCATTTCTAAACAACGCGATATCTACTGCTCCTGAAACCATATGGTACCCTCTTGATTTCAAATTCTCAGGA
CTATCATGAGGCATTGCAAATCCAGATAAATACGCCCCACCGTCAAGTGGCTTCTTCTTCAATGCTCCTTTTTCAGCTGTATTCATCATCTCCTT
CACTTTCTTATTCCCAGGATCCCATAAGTACCCTAAACTCGCACTCAAATCCAATGGTCCCATTTGAATACAATCAACCCCTTCCACTGCTGCAA
TTTCATCAATCTTCTTCACTCCATCTACACACTCAACTTGACACATGATCAGTAGATCATCCTCGTAATTACTCAAATACCCTTCATCAATTCCA
TAGCTCGAAGCTCTAACAACAGTATGAGCAGATCCACGTACGCCATTAGGCGGGAAACGGCAGTAAGACACTGCCTTTCGGGCTGATTTCGGACC
GTCGATCATCGGAAACATAATGCCCTGTGGGCCCGAGATCGAGGGGTTTTTTTACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E380000] SGN-U582679 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185 [Download] [View] Facility Assigned ID: 227_C04_TUS01C4.Td_024.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0044 Quality Trim Threshold: 20.5