EST details — SGN-E380039

Search information 
Request: 380039Match: SGN-E380039
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168602Clone name: TUS-3-I16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6795 [cLEC-36-M23] Trace: SGN-T31066 EST: SGN-E207478 Direction: 5' Facility: TIGR
Clone: SGN-C168602 [TUS-3-I16] Trace: SGN-T1036 EST: SGN-E379436 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E380039Length: 639 bp (787 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E380039 [] (trimmed) CAGGCCACTTCTGATGTGCTGTCTTAGTCTTCCGATTTTCCCTCTTGCTGCTTTTCTTGTCGAGAAAATGGCACAGAAGAAGTATATGACTGAAC
ATGTAGTTGTCACTCTTCACATAATTATAACGACAGCTTCCATTTTGTATCCAGTTCTGGTCATCCTCAGGTGTGATTCTGCTTTTCTATCGGGT
GTCACACTGATGATGTTTGCTTGCATTGTGTGGATGAAACTAGTTTCTTATGCACATACAAATTATGATATGAGACAGCTTGCAAAGTCTGTGAA
TGAGGGTGAGAATTCCGAAATCAACTACTCTTACAATGTTAGTTTCGAGAGTTTGGCTTACTTCATGGTTGCTCCAACTTTATGCTATCAGGGTT
GGCTGGCCCGCCAACTCATCAAGCTGGTAATTTTTACAGGATTAATGGGATTTATCATTGAGCAGTATATTAACCCGATTGTGCGAAGCTCACGA
CATCCATTTGAAGGAAACCTTTTATACGCCATCGAGAGGGTATTGAAGCTTTCAGTTCCAATTTTATATGTCTGGCTCTGCATGTTCTACAGCCT
CTTTCATCTTTGGTTAAATATACTTGCGGAAGTTCTGCGATTTGGGGATCGTGAGTTCTANTAAGATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E380039] SGN-U564273 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T726 [Download] [View] Facility Assigned ID: 234_A04_TUS03I16.T3_022.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5