EST details — SGN-E389477

Search information 
Request: 389477Match: SGN-E389477
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168839Clone name: TUS-4-C13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168839 [TUS-4-C13] Trace: SGN-T191310 EST: SGN-E389984 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E389477Length: 453 bp (793 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E389477 [] (trimmed) AAGAGTAATTATGTAACAAGACGGTTAATTAGTAATCTGGTAACCAAATTTATATCTCTTAATCAAATTTTCTTGTAAAAGTAAGTAACTTATAT
ATTTATTTTCTATAAGTAATAAATCTATAATAATGACATACAAAAAGATAGCCATATAGATCCAAAGTTTGATTTGGACTTTTGGTGAAAAGGCC
CAATTAAAATGTAAAAAGGGCCCTAGTATGGCCCAACATGTTAGATTCACATAATTGAGCATCCAGATGCATTCTTTTCACTAAAGTAATCACAT
TTGTTCACATAACATCCCTTTGGGAGTCCATAGGGTATGGGCCCGGGCCCGGGCCCATATCCGTATGAATATGTGTCGTACCATGGTGGTGGTGG
AGGTGGTTGTACTGGTCTTCCGTACCAATTATCATGATAACAAGGGCCTCCAGTATAGCCTTCGTAACATTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E389477] SGN-U578859 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190803 [Download] [View] Facility Assigned ID: TUS04-C13.Td
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0117 Quality Trim Threshold: 14.5