EST details — SGN-E389494

Search information 
Request: 389494Match: SGN-E389494
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168860Clone name: TUS-4-D10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168860 [TUS-4-D10] Trace: SGN-T191082 EST: SGN-E389756 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E389494Length: 778 bp (802 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E389494 [] (trimmed) AGTTCTCTTCTATTTTTATCACGTAGTCAGGTAACAAATTATTAAGACATCCTACATCATGGGTAACTTTGAACCTATATCAAATATAAGATACA
ATGAACCTTATAAAGAGGTAGTTCTCTTCCCGTTTTTATTACAGTAAGACAACAAAATTGTTAAGACATCCCACACCATGGGTAACTCAAATCTT
TATCAAATATAACATCCAATAAACCTTGTAAAGAGGCAGTTCCCTTCCCATTTTTATTACAGTAGTAAGACAATAAAATTGGAGGAATGGTTCAT
TAACTTAAAATGTAGCATATGAAGGAGCTGGCAAGAAAGGAAATGGAGCAACCGAGGCATATGCTACAGGTGGCCGGCGTTGACCATTTCCTATG
GACTGCTTTCTTTTTTCTTCTTGTGCCGCTTCTGCAGTTTCCAATGAAGGTGACAGCTCGATAATCTTACTCATGTGTTCAATAGTCATTTGCTG
TTCACTCTCGGTAACACGATGAACTAGAAGCCCAGACATAAATACAGGAAGATACAGAAGGCTGGCATGGAACATTCTCCTAGCATCTTTGGTTG
TACGGTTCAAGTAGAATGATATTGCTGTACCGCTGATTGCCAGAGCAAGAAGTGTCGATTCCAGGCAAAACCACCCAGATGTTAAACTCCCTGCA
CACACAAGGTCGCCACAGAAGGTAGTCTAGATAGAAGCATGAAGAGCAAGGATTGAACATTAAGAACGTGCAATCAAACTAACCACACCACACCA
GATGTGCCCAATTCAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E389494] SGN-U575159 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190820 [Download] [View] Facility Assigned ID: TUS04-D10.Td
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0040 Quality Trim Threshold: 20.5