EST details — SGN-E389689

Search information 
Request: 389689Match: SGN-E389689
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169116Clone name: TUS-4-O2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169116 [TUS-4-O2] Trace: SGN-T191274 EST: SGN-E389948 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E389689Length: 625 bp (792 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E389689 [] (trimmed) ATATTTTGTTACACAAAAAGATAAGATACTACACTATGTATTATGCAACAACCACTTCCTACATCATCATAGTATCTCTTGAATAACAAAATCAA
CAATGTTCAACAACAAAATTATTCAAAATATCTGAATCCTGGTTCTATGGGCAACACCTAATTGATCAAATATTTCCATGATCAAACTTTACTAA
CCCTTTACTAACATCATCATTAGTCCATTACTATCTCAGACTTGCAATTTTCCTTAGCACCATCACTTTCTGGCTTTTCCTTAGTCTCCATCGAC
GTCCCATTTTCGTTCACATCATCAGCCCTTTTCGCGTCTTCTGCAGCAGCTGCTGCTTCTTTCTTTTTCTTTTCGTTCTCGTTCTCTTCCTTCTC
CTTCTCTGCCTTTTCTTCCTCAGCCTTCAATTTTGCTTCCACCTTTGCTGTTTCAATAGCTTTAACTAACCTCTCCAAGCAAGTATCTGCATTTT
CCTTAGAAGACTTGGGCATCAAACTCTCAGCAACATCAGCTGGAGTTATATTAGTTTCCCCTAATAAACGATGAATCTCAGGAAAGTAATCATCA
TGAGACGTAACGTCTAGATAATTATTAGCAAGCACCTTGAAGGGACTCAAACAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E389689] SGN-U571250 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191015 [Download] [View] Facility Assigned ID: TUS04-O2.Td
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5