EST details — SGN-E389710

Search information 
Request: 389710Match: SGN-E389710
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169147Clone name: TUS-4-P9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15057 [cLED-10-F18] Trace: SGN-T51262 EST: SGN-E231411 Direction: 5' Facility: TIGR
Clone: SGN-C169147 [TUS-4-P9] Trace: SGN-T191295 EST: SGN-E389969 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E389710Length: 656 bp (805 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E389710 [] (trimmed) CTCTTATGTACAAACAGCTACCTATATTTGGTCAGCACTTACATATAGTTGTTACACTACTTATAACATCAATGCTTAACCAAACACTTCAAATT
ATATATAAGCAATATATAAAAACTATATAATTCGTTATAACGATGTTTCACTCCTTTGTCTACGCATATGTGCACCCCATGACATATTGTTACCA
GAGTCCTTGTGTGAGTTTCTTCTTTTCAACTCCGATAGCTGAGAATGCCATCGATTCTTCCATTCACCGGTGTTCTCCATTGACTCATCATTTTG
GCACTTTCTACGAGGAGAAAATGCAAAATGAAGTCCTTTAGACATATGTTTGTCATACATATCTCTTGATTTAGGATCCGATAATGTCTCATAAG
CCTCTTGAACCCGAATAAACCTTTGGGTATTTTCTTCGACCCGACCCGGAGGTGAAACATCTGGGTGGTACTTTCTTGCTAATTGTTTGTACGCT
TGTTTAATTTCTAATAAAGAAACAGTTTCTTGAATACCCAAAAGCTCATAAAAGCTTTTTGATTCACTAATTTCTATCACATTGTTGTTAAGTTT
TGAGTTTACTCTAAAAGACACTTTTTGAGTTCTTGAAAATTGGGGATTTGATGGGGAAAATAGGACACGATCTATTGGGGTTCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E389710] SGN-U581004 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191036 [Download] [View] Facility Assigned ID: TUS04-P9.Td
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5