EST details — SGN-E389735

Search information 
Request: 389735Match: SGN-E389735
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168808Clone name: TUS-4-B6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168808 [TUS-4-B6] Trace: SGN-T190797 EST: SGN-E389471 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E389735Length: 731 bp (787 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E389735 [] (trimmed) CAATGGCGTTCTCTGCAACTCTTCGATGTTCATCTTCTCTACACCGCCCTTCGAAGAATTCAACAATTTCAAGCGTTTTGCCTCAATCATCTTCT
TCAATCTCCTTTCGATCTTCGCCTTCGTTTTTTAATCGCAAAAAATCATTGTCTATTCGATCTGCTACACTTGAAGCAGCACCTGCATCTGGAGG
AGTAGCACCTGCAATTTCCTTAACTGACAATGCATTAATGCACTTGAATAAAATGAGGAGTGATCGGAATGAGGACTTGTGTCTTAGAATTGGCG
TTAAACAAGGGGGATGCTCGGGAATGTCATACACTATGGAGTTTGAAAAGCGAGAAAATGCTAGACCAGACGATTCAATCATCGAGTACAATGGA
TTTGTTATTGTTTGTGATCCAAAAAGCCTTCTCTTCATCTTCGGAATGCAACTGGACTACAGCGATGCATTGATAGGCGGGGGCTTCTCTTTCAA
AAATCCAAACGCTACGCAAACTTGTGGTTGTGGAAAATCGTTTACTGCTGAGATGTAAGAGCATGCAGTCTTAGAAATGTACTACAAAATTAACA
TACTAGAACACCAACTGTGGTTTGCTTGGTTCTCTGAATATAGACAGAGACAGTAATGAAGATCTGTTAACTCATATTATGTGCATAAGGGACTG
TAACGTTTAAATATGTGTAACTGGGAATGCATTATATTCTTCCTGCACAAATACAAACATCTATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E389735] SGN-U575652 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191061 [Download] [View] Facility Assigned ID: TUS04-B6.T3
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5