Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E390001

Search information 
Request: 390001Match: SGN-E390001
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168893Clone name: TUS-4-E19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17596 [cLED-1-F7] Trace: SGN-T48596 EST: SGN-E227084 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390001Length: 682 bp (774 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E390001 [] (trimmed) CAGCTTCAAAGTAAGTATTTTAAGTTTTGAACTAGTGTTACTTATCTTGTTGGGAACTGTTTTGTTTGATTTTTAAAAGAAAAAATATTAAATGA
TCAAAAAAATTATAATATCTTTTTTGTTTTAAGGTTAAATAAATTGATTTAAAAATTTCATTTTTAATTAAAAGAGGGTAGTAAAATGCTTAAAA
AGCTAAAATAATTTAGTGTGAAATATATTATTTTATTATCATTCTAATCAAAATTTCTGGTCACACCTTATAGCATAGGGGTTTCAGAGGGCCCC
GAGATATTTTGTTTTGATCTTATATTTCTCGAATCTATGAAAATGTTATTCCACTAGTGTTTATATTATTTTCTGAAATGCATATTTTTGAATGA
TTTGATATATGCTCAATATTTTCATGCAAAACTGAAAATGAATTTTGGTATTATTGACCGTATTTGTATTGTTTTACTCTCCAAAAATATTATCG
ATCGCATCTATCTTTGTATTTATACAGGCTTGGACAAATGGTCGATTGCATTCACCTCTCCACAGAGTAACAATGTCCGGACAAAATGATAGACT
CTCCATTCAATTGTTTTCATTATCAAAGCCAGGTCACTTCATCCAGGCACCAAAAGAACTAGTAGATGAAGAACACCCATTACTCTTNCAGCCAT
TTGAAATTCTTGAATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390001] SGN-U577701 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191327 [Download] [View] Facility Assigned ID: TUS04-E19.T3
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5