Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E390376

Search information 
Request: 390376Match: SGN-E390376
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183147Clone name: TUS-41-G17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183147 is on microarray TOM1 spot ID 1-1-8.3.3.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64455 [cLEM-6-D13] Trace: SGN-T84460 EST: SGN-E270704 Direction: 5' Facility: TIGR
Clone: SGN-C183147 [TUS-41-G17] Trace: SGN-T191491 EST: SGN-E390165 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390376Length: 715 bp (892 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390376 [] (trimmed) ATATTAAATGCCATTAATTCAAAAGATGAAGGGAACACAACAAAGTAAAATTACTACCGTTTCTCCAGAGAAAAACTTTAAGGAGGATTCAAACA
AGCTTCCCCTAAATACATAGGGTCAGTTATACATTACATAATTAAAAATTGGCATTTTAGTATCCTTCGGGCTTGTAAGCGATGAAACTGATGCA
CTGCACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGAGGGTAAGCCTTCTTTGCCTCCTGCACCTCAGCCAAGACCTGGGTTG
CATCAGTGCACCCAAACATGGGCAACTTCCACATGGTCCAGTATCTGCCATCGTAGTATCCTGGTGACTTATGGTTCTCACGGTACACAAATCCG
TGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTTTCAATAGGTACTCAATTTCGCTGAGCAATTGCTCGTCGGACAAATCAGGAAGGTA
CGACAGAGTCTCGTACTTCTTCATGTTAATTGGTGGCCACACCTGCATGCAACTGACTCTTCCACCGTTGCTAGCAATGGAGGTAATGTCAAGGT
TTTGCTGAAGATGCGATATTATTCGGTGGATTCAACAATTTGAATTCAAAAAAGGAGAACGAGGACGAAGATCACCAACTCTACTTCCATGGAAG
TATGAATGAGGAGGATCATATATTAACCAAAGATTTCTTGGGGTTAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390376] SGN-U580994 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191702 [Download][View] Facility Assigned ID: FA0AAD29AD09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0071 Quality Trim Threshold: 20.5