EST details — SGN-E390482

Search information 
Request: 390482Match: SGN-E390482
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182799Clone name: TUS-40-I5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182799 is on microarray TOM1 spot ID 1-1-4.1.6.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C112259 [cTOA-14-M7] Trace: SGN-T125888 EST: SGN-E313045 Direction: 5' Facility: TIGR
Clone: SGN-C182799 [TUS-40-I5] Trace: SGN-T191592 EST: SGN-E390266 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390482Length: 657 bp (900 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390482 [] (trimmed) AATATAGTTCTTGTAAACTTGATTGAAATTCGAATTAATCATACACGGAATAAAAAGATGGAAAACAAGGGAAAATGAATACAATTTCTCAAGGG
AAAACCCAAAGGAGAATTCAAACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTCTAGAACTTAGTATCCTTCGGGCTTGTAACCGATGAA
ACTGATGCACTGCACTTGACGAACATTGTCAAATCCGATGATACGGACCCATGCCTGTGGGTAAGCCTTCTTTGCCTCCTGCACCTCAGCCAAGA
CCTGGGTTGCATCAGTGCACCCGAACATGGGCAACTTCCACATGGTCCAGTATCTGCCATCGTAGTATCCTGGTGACTTATGGTTCTCACGGTAC
ACAAATCCGTGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTTTCAATAGGTACTCAATTTCGCTGAGCAATTGCTCGTCGGACAAATC
AGGAAGGTACGACAGAGTCTCGTACTTCTTCATGTTAATTGGTGGCCACACCTGCATGCAACTGACTCTTCCACCGTTGCTAGCAATGGAGGTAA
TGTCAAGGTTTTGCTTCCTTGAAACAGGGAAAGAACCGGTGGACTTTGAGTCCAGTGAAGGGTGCAACCATGCTAGCTTGTGCACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390482] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191808 [Download][View] Facility Assigned ID: FA0AAD28AE03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0077 Quality Trim Threshold: 20.5