Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E390532

Search information 
Request: 390532Match: SGN-E390532
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182771Clone name: TUS-40-H1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182771 is on microarray TOM1 spot ID 1-1-8.4.6.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C132318 [cTOD-2-E5] Trace: SGN-T141825 EST: SGN-E329211 Direction: 5' Facility: TIGR
Clone: SGN-C182771 [TUS-40-H1] Trace: SGN-T197589 EST: SGN-E396263 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390532Length: 479 bp (829 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E390532 [] (trimmed) GGTTAAGGGGGGTCTTCCATTGCCACACCTAATTGGAAATCTCTGATGCAAGGCTTTGGGTAAATATTCTATTTAGTTAGCTAATGCTTTCCGGG
TATGCAGATTAACTGTATGCATTTCTAGATATATGCGCAAAGTCTGGAACTTTTTGCAAGATTTACAGCATAGGGTCTCAAGCTGGGGTGTTGAT
TGTGAAACAATTGGTGTTTGATTAGTCTTTTGATTGCTTGATCATTTGGGTTGCTTGATATATGCACAAGTACGGGACTTTGACAAGATTTAGGA
ATAATTGTGTTTTTGCAAGTACTTGATTGCCTAGACCATTTGGGTGAGTTGATAATAGCAGTATCATGCAAAGGTATGGTGACAAGTACATGGAA
AAAGTATGTATACCCTTGTTGGAAGCCTACATTAGATAATGAACGTGAAAATAGCAGCAGTAGAGGACGAGACCCTGGCGGAAGTGTTGATGGAT
TGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390532] SGN-U567733 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191858 [Download][View] Facility Assigned ID: FA0AAD28CD01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5