EST details — SGN-E390855

Search information 
Request: 390855Match: SGN-E390855
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185408Clone name: TUS-47-E22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185408 is on microarray TOM1 spot ID 1-1-3.1.9.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71980 [cLER-19-M18] Trace: SGN-T96584 EST: SGN-E285012 Direction: 5' Facility: TIGR
Clone: SGN-C185408 [TUS-47-E22] Trace: SGN-T197603 EST: SGN-E396277 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390855Length: 340 bp (816 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390855 [] (trimmed) TACAAATCCATATTATCAAACTTCATACACATAAGGCACATACATATGCACTTACATACAGAAATATCAAATACAGTACTAACAATTATCCTTCA
GAATCCAAAAAAAACAAAAGTGAAGGAAATGAAAAACACTTAAAAACCAAAACAACACAGAAACACAATCATAACATCCCAAAAGTAAAATTAAA
AAAACATTTCATTTCATTTAGTCTTTTTCCTTCTCCTTTTCCTCTTCAGCCTTTGAGTGGTATCCTGGTAATTTCTCCTTAATTTTGTCCAAAAA
TCCCTTCTTCTCCTTCCCCTCCGCCTCATGCTCCACCGCAGCCGGTGGTGGTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390855] SGN-U581375 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192181 [Download][View] Facility Assigned ID: FA0AAD35BC11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.914 Expected Error Rate: 0.0002 Quality Trim Threshold: 14.5