EST details — SGN-E392328

Search information 
Request: 392328Match: SGN-E392328
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180992Clone name: TUS-35-M22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180992 is on microarray TOM1 spot ID 1-1-3.1.17.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C68222 [cLEN-3-L20] Trace: SGN-T87990 EST: SGN-E273394 Direction: 5' Facility: TIGR
Clone: SGN-C180992 [TUS-35-M22] Trace: SGN-T193895 EST: SGN-E392569 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392328Length: 652 bp (818 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E392328 [] (trimmed) ATTTGTTCATTAAGCAAGCACAACAATATTCAAAGGGTAGGCCAAGTTACCCTCAAGAATTATTCAATTTCATTGCTTCTAAAACACCTTCTCAT
GATCTTGTTTGGGATGTTGGTACTGGTAGTGGCCAGGCTGCTCAATCTTTAGCTAAGCTTTACAAGAATGTGATAGCTACAGACACAAGTCCAAA
GCAGCTTGAATTTGCAGCAAAGGTTCCAAATGTTCAATACATATGTACCTCTCCTAAGTTGTCAAAATCCGAAATCGAAACAAAAATAGGATCAG
AATCAAGTGTAGATTTAGTAACAATTGCACAAGCAATGCATTGGTTTGATCTACCAACTTTTTATGAACATGTTAAATGGTTACTCAAGAAACCA
AATGGTGTTATAGCATCATGGTGTTACACTACACCTAAAATAAACAACTCAGTAGATGCAATATTTGATAAATTTTACACAAGTGATGCTGGACC
TTATTGGGAATCACCAAGAAAATTGGTCGATGAAAAGTATGAAACTATTGATTTTCCATTTGAGGCTATAGATGGATGTGATCATAATGGACCAT
TTGAGTTCAAGATTGAGAAAGTTATGGACTTGGATTCTTGTTTTACATACTTGAAGTCATGGTCAGCTTATCAAACTGCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392328] SGN-U580752 Tomato 200607 Build 2 98 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193654 [Download][View] Facility Assigned ID: FA0AAD23BG11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5