Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E392682

Search information 
Request: 392682Match: SGN-E392682
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181255Clone name: TUS-36-H21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181255 is on microarray TOM1 spot ID 1-1-4.4.14.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17896 [cLED-21-D4] Trace: SGN-T54093 EST: SGN-E240692 Direction: 5' Facility: TIGR
Clone: SGN-C181255 [TUS-36-H21] Trace: SGN-T194007 EST: SGN-E392681 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392682Length: 470 bp (837 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E392682 [] (trimmed) CAGATTGCAACACCACCAAGTGAGATGGACAATGAAGTGGGCAGAGCGGATCCTGAAGCATCTGCTGCTCCCATGGATACAGATGCAGGAATAGC
TACTGTTAACATATGTCAGGAAGAAACTCCTACTCCGGAGGATAACCAGAAGCAAAGCTCTGACACAGATGTTGCTCAAGAAGCAGGGCAGATTG
AAGCAGACACAGAAGCAGAGACGGGGATGATTGATGGAGAAACAGATGCAGAAGATCTAGATACAGCAGGATAATCCAAGTGTGTATTGGATTGT
GCACCATGCCGGTGTAACTTGTGTCAACAATCCACTTAATCTGGGCTCAATTTGTACCATGTAACTTAAGTCAGTTGCTTAAGAAGCTTGACAGC
AAAAAAAAAAATAAATTAAAAATTACACAATTTAGAATTAATTACACATTTTTGCATAGATCTTAATTGTTGAGAGGTGGGATTTGTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392682] SGN-U567368 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194008 [Download][View] Facility Assigned ID: FA0AAD24CD11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0003 Quality Trim Threshold: 14.5