Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E392738

Search information 
Request: 392738Match: SGN-E392738
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181781Clone name: TUS-37-N19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181781 is on microarray TOM1 spot ID 1-1-6.2.12.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C140342 [cTOF-12-A13] Trace: SGN-T155890 EST: SGN-E343933 Direction: 5' Facility: TIGR
Clone: SGN-C181781 [TUS-37-N19] Trace: SGN-T194065 EST: SGN-E392739 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392738Length: 621 bp (835 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392738 [] (trimmed) ATCCAATCATTGTATTCATTAAAACAATACAATACGATTTAATACAACACTAAACAATAGAAATAAGATACATCATGAACCACCAAACAAAGTGT
AAATGAACAACATCATAATATTAAGAAATACAAATTCAGGGAATCGGAATTAAATGAAATGTAAATTACACACACAAAAATAAATATATAAATTT
CAAATTAAAGATGAGAAGATGGACCAGCAATGTCAATGACAAAACGGTACTTAACATCATTGTTAGCAAGCCTTTCAAGTCCTTCATTAATTTGA
TCAGTAGTGATAATCTCTATATCACTTAATATGTTATGTTTTCCACATAAGTCCATCATTTCTTGTGTCTCTTCTATACTTCCTATCATGCTTCC
TTTCACTGTTCTTTTTCCAAAAATCATAGGAAAAGCAGGCAAATCAATTGGCTTATCTGGTGCTCCAACAATCACCAAAGTTCCATTCACTTTTA
AAAGCTCTAAGTAACTCCCAAGTGAGTGTTTGGCTGATACTGTATCCAAAATAAAGTCAAGAGTTCTTTTCTTTTCCATCATTTGTTTGGGATTA
GTGCTTATTATAAAATCATCAGCACCTAAGTTGTGTTTGGCTTCTTGTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392738] SGN-U569435 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194064 [Download][View] Facility Assigned ID: FA0AAD25CG10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5