EST details — SGN-E392855

Search information 
Request: 392855Match: SGN-E392855
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181098Clone name: TUS-36-B8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181098 is on microarray TOM1 spot ID 1-1-1.2.15.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17976 [cLED-21-I17] Trace: SGN-T53937 EST: SGN-E240536 Direction: 5' Facility: TIGR
Clone: SGN-C181098 [TUS-36-B8] Trace: SGN-T194075 EST: SGN-E392749 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392855Length: 616 bp (855 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392855 [] (trimmed) ACCAAAACCAAAAACCAATACTGAATTACTTTTTTTAAAAGCCACCAAATACCATATTTTGACATACAAACCACAGTTTGCAGGTCAATTAGGAT
ACAACTTTTCATTCTTGATATAATATTTGGCAAAAGTGGCACCATCAAAATGGGAAAATTTGGTGCATGAAGCTTTATCTCTATTTACAAAAATG
GCTATAGGTCAACACCAAAATGCTGCATGAAATACTGCAGCTTTGAATTCTGGATCTTTGGCAAAAGTAGCAATCGACAAATCCCAAAAAACAGT
GATTTACATGGATATCTACTTGTTGGAATTTCTTTGCCATCTTTCAAAGATTGGATTATCCACAACGCCTTTTGCAAAAGGACAACGTGTTGGAT
CTGGGTCCATCATTGCCTTGAGTAAATTCTGAAATTGCAAGGAGTGACCCGGAAGAAGAGGCAATTTCCCCTCCCTGAGGTTTAAAAAATGAGGC
CCTGATTCTGGCAGTGAAAACCCTCTAATAAGTTCATATATTGCAGCGCCCAAGGAGAATATGTCAACTTTGTCAAGATGATCATAGTTCTCATT
AAGTATTTCTTGGGGCATATAACGTGCATCACCCTCTTCAATTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392855] SGN-U567234 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194181 [Download][View] Facility Assigned ID: FA0AAD24DA04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5